Review



plx 311 krab dcas9  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc plx 311 krab dcas9
    Plx 311 Krab Dcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plx+311+krab+dcas9/pLX_311-KRAB-dCas9+(Plasmid+%2396918)/bio_rxiv__64898__2026__03__13__711679-66-12-13
    Average 93 stars, based on 28 article reviews
    plx 311 krab dcas9 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Construct:

    Article Title: The human Y and inactive X chromosomes similarly modulate autosomal gene expression.
    Article Snippet: We obtained the following constructs from Addgene for use in our experiments: 1) for CRISPRi, pLX_311-KRAB-dCas9 (Addgene: #96918), a KRAB-dCas9 blasticidin-selectable lentiviral expression vector38; 2) sgOpti (#85681), a puromycin-selectable structurally optimized guide RNA (gRNA) lentiviral expression vector67,68; 3) psPAX2 (#12260), a second generation lentiviral packaging plasmid; and 4) pCMV-VSV-G (#8454), a lentiviral envelope protein plasmid.69 We purified all plasmids using the EndoFree Maxi Kit (Qiagen). e8 Cell Genomics 4, 100462, January 10, 2024 Weused the top five guide sequences for ZFX and ZFY from the humanCRISPRi v2 gRNA library.50We tested these guides for ZFX or ZFY knockdown and chose the two guides that gave the most robust response for the final experiments. .. We obtained the following constructs from Addgene for use in our experiments: 1) for CRISPRi, pLX_311-KRAB-dCas9 (Addgene: #96918), a KRAB-dCas9 blasticidin-selectable lentiviral expression vector38; 2) sgOpti (#85681), a puromycin-selectable structurally optimized guide RNA (gRNA) lentiviral expression vector67,68; 3) psPAX2 (#12260), a second generation lentiviral packaging plasmid; and 4) pCMV-VSV-G (#8454), a lentiviral envelope protein plasmid.69 We purified all plasmids using the EndoFree Maxi Kit (Qiagen). e8 Cell Genomics 4, 100462, January 10, 2024 Weused the top five guide sequences for ZFX and ZFY from the humanCRISPRi v2 gRNA library.50We tested these guides for ZFX or ZFY knockdown and chose the two guides that gave the most robust response for the final experiments. .. Guide name Protospacer sequence Primer, forward Primer, reverse ZFX-2 GGGCGGCACCCGGGACTCAC CACCGGGCGGCACCCGGGACTCAC AAACGTGAGTCCCGGGTGCCGCCC ZFX-3 GGCACCCGGGACTCACCGGA CACCGGCACCCGGGACTCACCGGA AAACTCCGGTGAGTCCCGGGTGCC ZFY-1 GGCACGCGGGACTCACCCGA CACCGGCACGCGGGACTCACCCGA AAACTCGGGTGAGTCCCGCGTGCC ZFY-2 GTGCGGGCGGTCGGCGACAG CACCGTGCGGGCGGTCGGCGACAG AAACCTGTCGCCGACCGCCCGCAC IG-1 GACATATAAGAGGTTCCCCG CACCGACATATAAGAGGTTCCCCG AAACCGGGGAACCTCTTATATGTC IG-3 ACCACACGGAGTTACCATGG CACCACCACACGGAGTTACCATGG AAACCCATGGTAACTCCGTGTGGT To clone guides into the sgOpti vector, we digested using FastDigest BsmBI (ThermoFisher) and dephosphorylated the ends with FastAP (ThermoFisher) for 30 min at 37 C. We gel-purified the digested plasmid using the QIAquick Gel Extraction Kit (Qiagen).

    Expressing:

    Article Title: The human Y and inactive X chromosomes similarly modulate autosomal gene expression.
    Article Snippet: We obtained the following constructs from Addgene for use in our experiments: 1) for CRISPRi, pLX_311-KRAB-dCas9 (Addgene: #96918), a KRAB-dCas9 blasticidin-selectable lentiviral expression vector38; 2) sgOpti (#85681), a puromycin-selectable structurally optimized guide RNA (gRNA) lentiviral expression vector67,68; 3) psPAX2 (#12260), a second generation lentiviral packaging plasmid; and 4) pCMV-VSV-G (#8454), a lentiviral envelope protein plasmid.69 We purified all plasmids using the EndoFree Maxi Kit (Qiagen). e8 Cell Genomics 4, 100462, January 10, 2024 Weused the top five guide sequences for ZFX and ZFY from the humanCRISPRi v2 gRNA library.50We tested these guides for ZFX or ZFY knockdown and chose the two guides that gave the most robust response for the final experiments. .. We obtained the following constructs from Addgene for use in our experiments: 1) for CRISPRi, pLX_311-KRAB-dCas9 (Addgene: #96918), a KRAB-dCas9 blasticidin-selectable lentiviral expression vector38; 2) sgOpti (#85681), a puromycin-selectable structurally optimized guide RNA (gRNA) lentiviral expression vector67,68; 3) psPAX2 (#12260), a second generation lentiviral packaging plasmid; and 4) pCMV-VSV-G (#8454), a lentiviral envelope protein plasmid.69 We purified all plasmids using the EndoFree Maxi Kit (Qiagen). e8 Cell Genomics 4, 100462, January 10, 2024 Weused the top five guide sequences for ZFX and ZFY from the humanCRISPRi v2 gRNA library.50We tested these guides for ZFX or ZFY knockdown and chose the two guides that gave the most robust response for the final experiments. .. Guide name Protospacer sequence Primer, forward Primer, reverse ZFX-2 GGGCGGCACCCGGGACTCAC CACCGGGCGGCACCCGGGACTCAC AAACGTGAGTCCCGGGTGCCGCCC ZFX-3 GGCACCCGGGACTCACCGGA CACCGGCACCCGGGACTCACCGGA AAACTCCGGTGAGTCCCGGGTGCC ZFY-1 GGCACGCGGGACTCACCCGA CACCGGCACGCGGGACTCACCCGA AAACTCGGGTGAGTCCCGCGTGCC ZFY-2 GTGCGGGCGGTCGGCGACAG CACCGTGCGGGCGGTCGGCGACAG AAACCTGTCGCCGACCGCCCGCAC IG-1 GACATATAAGAGGTTCCCCG CACCGACATATAAGAGGTTCCCCG AAACCGGGGAACCTCTTATATGTC IG-3 ACCACACGGAGTTACCATGG CACCACCACACGGAGTTACCATGG AAACCCATGGTAACTCCGTGTGGT To clone guides into the sgOpti vector, we digested using FastDigest BsmBI (ThermoFisher) and dephosphorylated the ends with FastAP (ThermoFisher) for 30 min at 37 C. We gel-purified the digested plasmid using the QIAquick Gel Extraction Kit (Qiagen).

    Article Title: The Parkinson’s disease risk gene cathepsin B promotes fibrillar alpha-synuclein clearance, lysosomal function and glucocerebrosidase activity in dopaminergic neurons
    Article Snippet: .. To generate CRISPRa and CRISPRi parental cell lines, lentivirus was used to stably transduced RPE1 cells with either pLX_311-KRAB-dCas9 [ ] (Addgene #96,918, henceforth referred to as CRISPRi) or EF1a-FLAG-dCas9-VPR [ ] (Addgene #114,195, henceforth referred to as CRISPRa) and single clones were selected and characterized to generate monoclonal parental lines stably expressing the CRISPRa and CRISPRi machinery. .. The gRNA sequences targeting our genes of interest were selected from previously published CRISPRa/i libraries [ ] (Supplemental Table 6), synthesized by IDT and cloned into pCRISPRi/a-v2 [ ] (Addgene #84,832).

    Plasmid Preparation:

    Article Title: The human Y and inactive X chromosomes similarly modulate autosomal gene expression.
    Article Snippet: We obtained the following constructs from Addgene for use in our experiments: 1) for CRISPRi, pLX_311-KRAB-dCas9 (Addgene: #96918), a KRAB-dCas9 blasticidin-selectable lentiviral expression vector38; 2) sgOpti (#85681), a puromycin-selectable structurally optimized guide RNA (gRNA) lentiviral expression vector67,68; 3) psPAX2 (#12260), a second generation lentiviral packaging plasmid; and 4) pCMV-VSV-G (#8454), a lentiviral envelope protein plasmid.69 We purified all plasmids using the EndoFree Maxi Kit (Qiagen). e8 Cell Genomics 4, 100462, January 10, 2024 Weused the top five guide sequences for ZFX and ZFY from the humanCRISPRi v2 gRNA library.50We tested these guides for ZFX or ZFY knockdown and chose the two guides that gave the most robust response for the final experiments. .. We obtained the following constructs from Addgene for use in our experiments: 1) for CRISPRi, pLX_311-KRAB-dCas9 (Addgene: #96918), a KRAB-dCas9 blasticidin-selectable lentiviral expression vector38; 2) sgOpti (#85681), a puromycin-selectable structurally optimized guide RNA (gRNA) lentiviral expression vector67,68; 3) psPAX2 (#12260), a second generation lentiviral packaging plasmid; and 4) pCMV-VSV-G (#8454), a lentiviral envelope protein plasmid.69 We purified all plasmids using the EndoFree Maxi Kit (Qiagen). e8 Cell Genomics 4, 100462, January 10, 2024 Weused the top five guide sequences for ZFX and ZFY from the humanCRISPRi v2 gRNA library.50We tested these guides for ZFX or ZFY knockdown and chose the two guides that gave the most robust response for the final experiments. .. Guide name Protospacer sequence Primer, forward Primer, reverse ZFX-2 GGGCGGCACCCGGGACTCAC CACCGGGCGGCACCCGGGACTCAC AAACGTGAGTCCCGGGTGCCGCCC ZFX-3 GGCACCCGGGACTCACCGGA CACCGGCACCCGGGACTCACCGGA AAACTCCGGTGAGTCCCGGGTGCC ZFY-1 GGCACGCGGGACTCACCCGA CACCGGCACGCGGGACTCACCCGA AAACTCGGGTGAGTCCCGCGTGCC ZFY-2 GTGCGGGCGGTCGGCGACAG CACCGTGCGGGCGGTCGGCGACAG AAACCTGTCGCCGACCGCCCGCAC IG-1 GACATATAAGAGGTTCCCCG CACCGACATATAAGAGGTTCCCCG AAACCGGGGAACCTCTTATATGTC IG-3 ACCACACGGAGTTACCATGG CACCACCACACGGAGTTACCATGG AAACCCATGGTAACTCCGTGTGGT To clone guides into the sgOpti vector, we digested using FastDigest BsmBI (ThermoFisher) and dephosphorylated the ends with FastAP (ThermoFisher) for 30 min at 37 C. We gel-purified the digested plasmid using the QIAquick Gel Extraction Kit (Qiagen).

    Article Title: A primordial germ cell-like-cell platform enables CRISPRi screen for epigenetic fertility modifiers.
    Article Snippet: To construct targeting vectors containing enhancer-reporter transgenes, PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers (Murakami et al, 2016) bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, #139098). .. Plasmid clones were validated by Sanger sequencing. pPyCAG-Pbase and pPB-CAGrtTA-IN (Addgene, #60612) were kindly provided by M. Azim Surani. pSpCas9(BB)-2A-PuroR (px459) V2.0 (Addgene, #62988), psPAX2 (Addgene, #12260), pMD2.G (Addgene, #12259), pLVtetO-Tfap2c (Addgene, #70269), pLX_311-KRAB-dCas9 (Addgene, #96918) and pXPR_050 (Addgene, #96925) were obtained from Addgene. ..

    Article Title: Tom20 gates PINK1 activity and mediates its tethering of the TOM and TIM23 translocases upon mitochondrial stress
    Article Snippet: .. The dCas9 plasmid used was pLX_311-KRAB-dCas9 (Addgene #96918, gift from John Doench & William Hahn & David Root; referred to as CRISPRi). gRNA plasmid cloning was adapted from Weissman lab protocols, using the pCRISPRi/a-v2 plasmid (Addgene #84832, gift from Jonathan Weissman). ..

    Article Title: A primordial germ cell-like-cell platform enables CRISPRi screen for epigenetic fertility modifiers
    Article Snippet: To construct targeting vectors containing enhancer-reporter transgenes, PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers (Murakami et al, ) bearing terminal Not I restriction sites were cloned into PCR4- Shh::lacZ -H11 (Addgene, #139098). .. Plasmid clones were validated by Sanger sequencing. pPyCAG-Pbase and pPB-CAG-rtTA-IN (Addgene, #60612) were kindly provided by M. Azim Surani. pSpCas9(BB)-2A-PuroR (px459) V2.0 (Addgene, #62988), psPAX2 (Addgene, #12260), pMD2.G (Addgene, #12259), pLV-tetO-Tfap2c (Addgene, #70269), pLX_311-KRAB-dCas9 (Addgene, #96918) and pXPR_050 (Addgene, #96925) were obtained from Addgene. ..

    Purification:

    Article Title: The human Y and inactive X chromosomes similarly modulate autosomal gene expression.
    Article Snippet: We obtained the following constructs from Addgene for use in our experiments: 1) for CRISPRi, pLX_311-KRAB-dCas9 (Addgene: #96918), a KRAB-dCas9 blasticidin-selectable lentiviral expression vector38; 2) sgOpti (#85681), a puromycin-selectable structurally optimized guide RNA (gRNA) lentiviral expression vector67,68; 3) psPAX2 (#12260), a second generation lentiviral packaging plasmid; and 4) pCMV-VSV-G (#8454), a lentiviral envelope protein plasmid.69 We purified all plasmids using the EndoFree Maxi Kit (Qiagen). e8 Cell Genomics 4, 100462, January 10, 2024 Weused the top five guide sequences for ZFX and ZFY from the humanCRISPRi v2 gRNA library.50We tested these guides for ZFX or ZFY knockdown and chose the two guides that gave the most robust response for the final experiments. .. We obtained the following constructs from Addgene for use in our experiments: 1) for CRISPRi, pLX_311-KRAB-dCas9 (Addgene: #96918), a KRAB-dCas9 blasticidin-selectable lentiviral expression vector38; 2) sgOpti (#85681), a puromycin-selectable structurally optimized guide RNA (gRNA) lentiviral expression vector67,68; 3) psPAX2 (#12260), a second generation lentiviral packaging plasmid; and 4) pCMV-VSV-G (#8454), a lentiviral envelope protein plasmid.69 We purified all plasmids using the EndoFree Maxi Kit (Qiagen). e8 Cell Genomics 4, 100462, January 10, 2024 Weused the top five guide sequences for ZFX and ZFY from the humanCRISPRi v2 gRNA library.50We tested these guides for ZFX or ZFY knockdown and chose the two guides that gave the most robust response for the final experiments. .. Guide name Protospacer sequence Primer, forward Primer, reverse ZFX-2 GGGCGGCACCCGGGACTCAC CACCGGGCGGCACCCGGGACTCAC AAACGTGAGTCCCGGGTGCCGCCC ZFX-3 GGCACCCGGGACTCACCGGA CACCGGCACCCGGGACTCACCGGA AAACTCCGGTGAGTCCCGGGTGCC ZFY-1 GGCACGCGGGACTCACCCGA CACCGGCACGCGGGACTCACCCGA AAACTCGGGTGAGTCCCGCGTGCC ZFY-2 GTGCGGGCGGTCGGCGACAG CACCGTGCGGGCGGTCGGCGACAG AAACCTGTCGCCGACCGCCCGCAC IG-1 GACATATAAGAGGTTCCCCG CACCGACATATAAGAGGTTCCCCG AAACCGGGGAACCTCTTATATGTC IG-3 ACCACACGGAGTTACCATGG CACCACCACACGGAGTTACCATGG AAACCCATGGTAACTCCGTGTGGT To clone guides into the sgOpti vector, we digested using FastDigest BsmBI (ThermoFisher) and dephosphorylated the ends with FastAP (ThermoFisher) for 30 min at 37 C. We gel-purified the digested plasmid using the QIAquick Gel Extraction Kit (Qiagen).

    Knockdown:

    Article Title: The human Y and inactive X chromosomes similarly modulate autosomal gene expression.
    Article Snippet: We obtained the following constructs from Addgene for use in our experiments: 1) for CRISPRi, pLX_311-KRAB-dCas9 (Addgene: #96918), a KRAB-dCas9 blasticidin-selectable lentiviral expression vector38; 2) sgOpti (#85681), a puromycin-selectable structurally optimized guide RNA (gRNA) lentiviral expression vector67,68; 3) psPAX2 (#12260), a second generation lentiviral packaging plasmid; and 4) pCMV-VSV-G (#8454), a lentiviral envelope protein plasmid.69 We purified all plasmids using the EndoFree Maxi Kit (Qiagen). e8 Cell Genomics 4, 100462, January 10, 2024 Weused the top five guide sequences for ZFX and ZFY from the humanCRISPRi v2 gRNA library.50We tested these guides for ZFX or ZFY knockdown and chose the two guides that gave the most robust response for the final experiments. .. We obtained the following constructs from Addgene for use in our experiments: 1) for CRISPRi, pLX_311-KRAB-dCas9 (Addgene: #96918), a KRAB-dCas9 blasticidin-selectable lentiviral expression vector38; 2) sgOpti (#85681), a puromycin-selectable structurally optimized guide RNA (gRNA) lentiviral expression vector67,68; 3) psPAX2 (#12260), a second generation lentiviral packaging plasmid; and 4) pCMV-VSV-G (#8454), a lentiviral envelope protein plasmid.69 We purified all plasmids using the EndoFree Maxi Kit (Qiagen). e8 Cell Genomics 4, 100462, January 10, 2024 Weused the top five guide sequences for ZFX and ZFY from the humanCRISPRi v2 gRNA library.50We tested these guides for ZFX or ZFY knockdown and chose the two guides that gave the most robust response for the final experiments. .. Guide name Protospacer sequence Primer, forward Primer, reverse ZFX-2 GGGCGGCACCCGGGACTCAC CACCGGGCGGCACCCGGGACTCAC AAACGTGAGTCCCGGGTGCCGCCC ZFX-3 GGCACCCGGGACTCACCGGA CACCGGCACCCGGGACTCACCGGA AAACTCCGGTGAGTCCCGGGTGCC ZFY-1 GGCACGCGGGACTCACCCGA CACCGGCACGCGGGACTCACCCGA AAACTCGGGTGAGTCCCGCGTGCC ZFY-2 GTGCGGGCGGTCGGCGACAG CACCGTGCGGGCGGTCGGCGACAG AAACCTGTCGCCGACCGCCCGCAC IG-1 GACATATAAGAGGTTCCCCG CACCGACATATAAGAGGTTCCCCG AAACCGGGGAACCTCTTATATGTC IG-3 ACCACACGGAGTTACCATGG CACCACCACACGGAGTTACCATGG AAACCCATGGTAACTCCGTGTGGT To clone guides into the sgOpti vector, we digested using FastDigest BsmBI (ThermoFisher) and dephosphorylated the ends with FastAP (ThermoFisher) for 30 min at 37 C. We gel-purified the digested plasmid using the QIAquick Gel Extraction Kit (Qiagen).

    Stable Transfection:

    Article Title: The Parkinson’s disease risk gene cathepsin B promotes fibrillar alpha-synuclein clearance, lysosomal function and glucocerebrosidase activity in dopaminergic neurons
    Article Snippet: .. To generate CRISPRa and CRISPRi parental cell lines, lentivirus was used to stably transduced RPE1 cells with either pLX_311-KRAB-dCas9 [ ] (Addgene #96,918, henceforth referred to as CRISPRi) or EF1a-FLAG-dCas9-VPR [ ] (Addgene #114,195, henceforth referred to as CRISPRa) and single clones were selected and characterized to generate monoclonal parental lines stably expressing the CRISPRa and CRISPRi machinery. .. The gRNA sequences targeting our genes of interest were selected from previously published CRISPRa/i libraries [ ] (Supplemental Table 6), synthesized by IDT and cloned into pCRISPRi/a-v2 [ ] (Addgene #84,832).

    Clone Assay:

    Article Title: The Parkinson’s disease risk gene cathepsin B promotes fibrillar alpha-synuclein clearance, lysosomal function and glucocerebrosidase activity in dopaminergic neurons
    Article Snippet: .. To generate CRISPRa and CRISPRi parental cell lines, lentivirus was used to stably transduced RPE1 cells with either pLX_311-KRAB-dCas9 [ ] (Addgene #96,918, henceforth referred to as CRISPRi) or EF1a-FLAG-dCas9-VPR [ ] (Addgene #114,195, henceforth referred to as CRISPRa) and single clones were selected and characterized to generate monoclonal parental lines stably expressing the CRISPRa and CRISPRi machinery. .. The gRNA sequences targeting our genes of interest were selected from previously published CRISPRa/i libraries [ ] (Supplemental Table 6), synthesized by IDT and cloned into pCRISPRi/a-v2 [ ] (Addgene #84,832).

    Article Title: A primordial germ cell-like-cell platform enables CRISPRi screen for epigenetic fertility modifiers.
    Article Snippet: To construct targeting vectors containing enhancer-reporter transgenes, PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers (Murakami et al, 2016) bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, #139098). .. Plasmid clones were validated by Sanger sequencing. pPyCAG-Pbase and pPB-CAGrtTA-IN (Addgene, #60612) were kindly provided by M. Azim Surani. pSpCas9(BB)-2A-PuroR (px459) V2.0 (Addgene, #62988), psPAX2 (Addgene, #12260), pMD2.G (Addgene, #12259), pLVtetO-Tfap2c (Addgene, #70269), pLX_311-KRAB-dCas9 (Addgene, #96918) and pXPR_050 (Addgene, #96925) were obtained from Addgene. ..

    Article Title: A primordial germ cell-like-cell platform enables CRISPRi screen for epigenetic fertility modifiers
    Article Snippet: To construct targeting vectors containing enhancer-reporter transgenes, PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers (Murakami et al, ) bearing terminal Not I restriction sites were cloned into PCR4- Shh::lacZ -H11 (Addgene, #139098). .. Plasmid clones were validated by Sanger sequencing. pPyCAG-Pbase and pPB-CAG-rtTA-IN (Addgene, #60612) were kindly provided by M. Azim Surani. pSpCas9(BB)-2A-PuroR (px459) V2.0 (Addgene, #62988), psPAX2 (Addgene, #12260), pMD2.G (Addgene, #12259), pLV-tetO-Tfap2c (Addgene, #70269), pLX_311-KRAB-dCas9 (Addgene, #96918) and pXPR_050 (Addgene, #96925) were obtained from Addgene. ..

    Sequencing:

    Article Title: A primordial germ cell-like-cell platform enables CRISPRi screen for epigenetic fertility modifiers.
    Article Snippet: To construct targeting vectors containing enhancer-reporter transgenes, PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers (Murakami et al, 2016) bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, #139098). .. Plasmid clones were validated by Sanger sequencing. pPyCAG-Pbase and pPB-CAGrtTA-IN (Addgene, #60612) were kindly provided by M. Azim Surani. pSpCas9(BB)-2A-PuroR (px459) V2.0 (Addgene, #62988), psPAX2 (Addgene, #12260), pMD2.G (Addgene, #12259), pLVtetO-Tfap2c (Addgene, #70269), pLX_311-KRAB-dCas9 (Addgene, #96918) and pXPR_050 (Addgene, #96925) were obtained from Addgene. ..

    Article Title: A primordial germ cell-like-cell platform enables CRISPRi screen for epigenetic fertility modifiers
    Article Snippet: To construct targeting vectors containing enhancer-reporter transgenes, PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers (Murakami et al, ) bearing terminal Not I restriction sites were cloned into PCR4- Shh::lacZ -H11 (Addgene, #139098). .. Plasmid clones were validated by Sanger sequencing. pPyCAG-Pbase and pPB-CAG-rtTA-IN (Addgene, #60612) were kindly provided by M. Azim Surani. pSpCas9(BB)-2A-PuroR (px459) V2.0 (Addgene, #62988), psPAX2 (Addgene, #12260), pMD2.G (Addgene, #12259), pLV-tetO-Tfap2c (Addgene, #70269), pLX_311-KRAB-dCas9 (Addgene, #96918) and pXPR_050 (Addgene, #96925) were obtained from Addgene. ..

    Cloning:

    Article Title: Tom20 gates PINK1 activity and mediates its tethering of the TOM and TIM23 translocases upon mitochondrial stress
    Article Snippet: .. The dCas9 plasmid used was pLX_311-KRAB-dCas9 (Addgene #96918, gift from John Doench & William Hahn & David Root; referred to as CRISPRi). gRNA plasmid cloning was adapted from Weissman lab protocols, using the pCRISPRi/a-v2 plasmid (Addgene #84832, gift from Jonathan Weissman). ..

    Transduction:

    Article Title: Energy Flux Regulates Cell Death Induced by California Serogroup Orthobunyaviruses
    Article Snippet: .. BE(2)-C cells were engineered to constitutively express dCas9-KRAB via lentiviral transduction of pLX_311-KRAB-dCas9 (Addgene, catalog #96918), which was a gift from John Doench and William Hahn and David Root [ ]. ..



    Similar Products

    93
    Addgene inc plx 311 krab dcas9
    Plx 311 Krab Dcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plx+311+krab+dcas9/pLX_311-KRAB-dCas9+(Plasmid+%2396918)/bio_rxiv__64898__2026__03__13__711679-66-12-13
    Average 93 stars, based on 1 article reviews
    plx 311 krab dcas9 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc lentiviral transduction
    Lentiviral Transduction, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plx+311+krab+dcas9/pLX_311-KRAB-dCas9+(Plasmid+%2396918)/bio_rxiv__64898__2026__03__13__711679-66-9-13
    Average 93 stars, based on 1 article reviews
    lentiviral transduction - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc dcas9 krab
    Dcas9 Krab, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plx+311+krab+dcas9/pLX_311-KRAB-dCas9+(Plasmid+%2396918)/bio_rxiv__64898__2026__03__13__711679-66-7-13
    Average 93 stars, based on 1 article reviews
    dcas9 krab - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc lentiviral vector plx 311 krab dcas9
    Lentiviral Vector Plx 311 Krab Dcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plx+311+krab+dcas9/pLX_311-KRAB-dCas9+(Plasmid+%2396918)/bio_rxiv__64898__2025__12__03__691936-94-7-19
    Average 93 stars, based on 1 article reviews
    lentiviral vector plx 311 krab dcas9 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plasmid plx 311 krab dcas9
    Plasmid Plx 311 Krab Dcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plx+311+krab+dcas9/pLX_311-KRAB-dCas9+(Plasmid+%2396918)/10__1158_slash_1535___7163__mct___25___0379-39-4-7
    Average 93 stars, based on 1 article reviews
    plasmid plx 311 krab dcas9 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plx 311 krab dcas9 addgene
    Plx 311 Krab Dcas9 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plx+311+krab+dcas9/pLV-tetO-Tfap2c+(Plasmid+%2370269)/pm41233591-385-120-121
    Average 93 stars, based on 1 article reviews
    plx 311 krab dcas9 addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc krab dcas9
    Krab Dcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plx+311+krab+dcas9/pLX_311-KRAB-dCas9+(Plasmid+%2396918)/pmc12358835__pnas%2E2425621122%2Esapp-19-7-8
    Average 93 stars, based on 1 article reviews
    krab dcas9 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results